FASTQ Reads: Phred+33 (Sanger / Illumina 1.8+) (.fastq)
Six 60-base reads with Phred+33 quality strings, the modern Sanger encoding used by everything since Illumina 1.8. Quality declines along each read the way real sequencing does, so a mis-decoded offset produces implausible scores rather than plausible ones.
@NX_READ_001 length=60
GGCGCGCACGTGGGGGCCCCCAAAAAGCTCTAATGGACTGAATATTGGGGCGTTCTGATA
+
FGHFHEGEFDGDFGHDHEEECCFGCFFBDCFBEFDBDCEAAACCEBB@CAB@ACAC@@BB
@NX_READ_002 length=60
AACTATCTTAGATAAGAGTAGACGAGAGCAACCAGACTACTTGTTGTGGGCTGCGAGGAC
+
GHFHHEGFFDFHDEEGGFFFEDDDFDFFEFEDBFDCEDEEDCACDADABBBBDBA?@CC@
@NX_READ_003 length=60
AGCGACAGATATAGCTTACCGCCGCGGCTATAAGCAAAGTGTGTCAACGAACGGCTTTCT
+
IFFFIHEIGHEDGGHDGHEDDGFGGCFBCBDCDEDDBCCCEEEBEBCBCDABBDCAABBC
@NX_READ_004 length=60
CAAGAGCATGGGCCCAATCCGTTGATTACTGAGCTTCATCGGATCCATTAACCGTCGGGT
+
HEFEEEIHIFFGHEGDEHCFCGGGEGDDFEEFCCEBEADBDCCEC@BCBBDDAD??AB??
@NX_READ_005 length=60
ACGGCAAGCCGAAAAGATATTATTGATTGATCTTACATTCGATCGGTTCGCAGACCCGAG
+
IFHIFGEHHEGEGFGFGFGDEGGCDCFFCDEFFEEEDCBCDCEADAACB@@CDBBC@@CC
@NX_READ_006 length=60
ACCCGCAGTTTGGAGTGCCTAGCGACTAATGTGACACTGTGGTATCGCTCCTTCTTAGGA
+
GGIFIHEIEEHEFGFHGFCCFGEFGDGECCECDBBBCADDDBABBDAA@DDABACB@A@A
Specifications
- Reads
- 6
- Read Length
- 60
- Encoding
- Phred+33
- Ascii Offset
- 33
- Quality Range
- 30 to 40
- Seed
- 20260848
- Lines Per Record
- 4
Testing contract
Expected to pass- Scenario
- Parse the four-line records and convert every quality character to a Phred score using an offset of 33.
- Expected result
- Six reads of 60 bases decode to scores between 30 and 40, and decoding with offset 64 instead yields negative scores.
What is a .fastq file?
FASTQ pairs each sequence with per-base quality scores. A record is exactly four lines: a `@` header, the sequence, a `+` separator that may repeat the header, and a quality line of the same length whose characters encode Phred scores as ASCII with an offset: 33 in the Sanger/Illumina 1.8+ encoding, 64 in older Illumina data. Misidentifying that offset silently shifts every quality value by 31.
How to use this file
Use an example .fastq file to test read parsers, quality-trimming tools, and encoding detection, verifying that sequence and quality lengths match, that a `@` at the start of a quality line is not mistaken for a new record, and that the documented offset is applied.
How to use this file for testing
“FASTQ Reads: Phred+33 (Sanger / Illumina 1.8+) (.fastq)” is a deterministic Testaroo fixture for Scientific data, Editor testing. Citation catalogs (BibTeX, RIS), chemistry structures (MDL Molfile, PDB), and gridded binary data (NetCDF, FITS), for testing reference managers, molecule viewers, and scientific-data loaders.
Documented properties for this file: seed 20260848 · Phred+33. Compare results against paired or grouped companions on this page when present (clean↔damaged, searchable↔scanned, or format twins) so scores stay reproducible across runs.
Download the file once, keep the path stable in CI or local scripts, and treat the spec table as the contract: dimensions, seeds, field lists, and roles are intentional. Corrupt or invalid samples are labelled as such, expect parsers to fail loudly rather than silently accept them.
Scientific fixtures are small, valid, and fully synthetic, no real organism, patient, sample, or observation. Point your parser or loader at the file and check it reads the documented records, variables, or headers; binary formats ship a readable twin or metadata listing for comparison.
Generated by generation/scientific.py. Free for any use, no attribution required, license.
Related files
- bedBED6 Intervals: 0-Based Half-Open Coordinates (.bed)The same six features as the GFF3 file expressed in BED's 0-based half-open coordinates, where the start is one lower and the end is unchanged. Confusing the two conventions shifts every interval by a base, and this pair makes that shift a visible diff.

- fastaFASTA Contigs: One Line Per Record (.fasta)The same four contigs written one sequence per line rather than wrapped, which is how many pipelines emit FASTA and how many line-oriented parsers assume it always looks. Comparing against the wrapped twin proves a parser joins continuation lines instead of taking the first one.

- fastaFASTA Contigs: Wrapped at 60 Columns (.fasta)Four 600-base synthetic contigs wrapped at the conventional 60 columns, with the length and an invented organism name in each header. The sequences come from a fixed seed, so they are reproducible and belong to nothing that exists.

- csvGenomic Coordinate Conventions: BED versus GFF3 Side by Side (.csv)Every interval written in both coordinate conventions with its length, which is identical either way. It is the lookup table for the most common bioinformatics off-by-one, and the length column is what proves a conversion did not quietly change an interval's size.

- gff3GFF3 Gene Annotations: 1-Based Inclusive Coordinates (.gff3)Seven features on a synthetic contig (two genes, an mRNA, two exons and two CDS records) linked by ID and Parent attributes across both strands. GFF3 coordinates are 1-based and inclusive, which is the fact its BED twin exists to contrast.

- fastqIntentionally Corrupt FASTQ: Final Record Missing Its Quality Line (.fastq)An intentionally corrupt FASTQ whose first five records are complete and whose sixth ends after the plus line, leaving no quality string. A four-line-block reader must report an incomplete final record rather than pairing the sequence with an empty quality string.
